Forest soil community analysis
From mothur
In this tutorial we will analyze bacterial and eukaryal forest soil microbial communities using some of the tools implemented in mothur. The long-term soil productivity (LTSP) experiment in British Columbia served to compare soil microbial community structures in harvested and naturally disturbed forest stands along replicated soil depth profiles. Two clone libraries, one for each domain, containing full length ribosomal intergenic spacer (RIS) regions linked to partial small subunit (SSU) rRNA genes were generated and compared to RIS community profiles. This tutorial will demonstrate how the two different genetic regions influence the community structure analysis by mothur. We will compare the information gained by the full-length SSU-RIS sequences to the information gained solely by SSU or RIS sequences respectively, and show how hypervariable regions affect our OTU-based analyses.
Contents |
Getting started
Obtaining sequences
The sequences from the two libraries can be downloaded from GenBank or, alternatively, directly retrieved from LTSP07.zip as BACT_SSURIS.fasta and EUKA_SSURIS.fasta. Here is a quick guidline to retrieve batch sequences from GenBank:
- Go to the NCBI homepage.
- Select NUCLEOTIDE from the SEARCH drop-down menu.
- Type “FJ550632:FJ552694 [ACCN]” or “FJ552695:FJ554464 [ACCN]” to retrieve the bacterial or eukaryal sequences and hit GO.
- Select FASTA under the DISPLAY menu and FILE under the SENT TO menu. Save it to your preferred location.
Since we will work with phylip formatted files, which allow only 10 digit sequence identifiers, the identifiers need to be trimmed. For this reason, the fasta files in LTSP07.zip contain sequences solely assigned with the GenBank accession numbers. We start the analysis using the bacterial dataset.
Generating alignments
The sequences contain non-coding regions, therefore we cannot use the 16S-based aligner implemented in mothur, but rather a target-independent alignment tool. In general, you can use your favourite software, however, I recommend using MAFFT for this dataset since this tool performs reasonably well with respect to accuracy and speed of aligning large sequence sets with hypervariable regions. Upload your sequences (e.g. BACT_SSURIS.fasta) to the server and use the default parameters to run MAFFT. Change format to FASTA and copy alignment into a text editor. We name the file BACT_SSURIS.almafft.fasta. MAFFT can also be downloaded and run locally.
Generating alignment subfiles
It will be interesting to see how the SSU part and RIS part of the sequences compare when clustering the sequences into OTUs. Therefore, we will create two additional sequence files from BACT_SSURIS.almafft.fasta, i.e. BACT_SSU.almafft.fasta and BACT_RIS.almafft.fasta. Open BACT_SSURIS.almafft.fasta in your favourite sequence alignment editor (e.g. BioEdit). Trim the alignment at the following conserved position on the 3’-end of the 16S:
- Bacteria: TGCGGCTGGATCACCTCCTT (Normand et al. 1996, Molecular Microbial Ecology Manual).
- Eukarya: TCCGTAGGTGAACCTGCGG (White et al. 1990, PCR Protocols: a Guide to Methods and Applications).
Trim sequences in order that BACT_SSU.almafft.fasta ends and BACT_RIS.almafft.fasta starts with this conserved positions. In case you have trouble splitting the alignment, I provided the subfiles in LTSP07.zip.
Generate phylip4-formatted file
Use ReadSeq or equivalent tools to convert the three aligned fasta files into phylip format. Use format phylip4 since phylip3.2 will not work with the newer phylip version. We name these files BACT_SSURIS.almafft.phy, BACT_SSU.almafft.phy, and BACT_RIS.almafft.phy.
Create distance matrix
Use the Phylip program DNAdist to generate a distance matrix from the phylip formatted alignment. The algorithm can be run online at several locations (http://trishul.sci.gu.edu.au/tools/dnadist.html, http://mobyle.pasteur.fr/cgi-bin/portal.py?form=dnadist) or can be downloaded and used according to the following instructions:
- Download the Phylip package.
- Copy the executable dnadist.exe into the directory with your data files and execute the program.
- When prompted for the input file type the name of the phylip formatted alignment file (e.g. BACT_SSURIS.almafft.phy).
- Create new outfile (e.g. BACT_SSURIS.almafft.dist).
- Press D to select Jukes-Cantor as distance. Default can be used for all other parameters.
- Copy the file into the mothur folder.
- Repeat procedure with the other files.
OTU-based analyses
Load distance matrix
We use the distance matrix created from our alignment in order to determine the number of operational taxonomic units (OTUs) in our dataset by using mothur. Start mothur and load the distance matrix by using the read.dist command:
mothur > read.dist(phylip=BACT_SSURIS.almafft.dist)
Clustering sequences
Cluster the sequences using the furthest neighbour algorithm. Alternatively, nearest and average neighbour can be used and compared. Since the data set is rather large and we are not interested in grouping very distant OTUs, we use a cut-off of 0.10:
mothur > cluster(cutoff=0.10)
Collector’s and rarefaction curves
We want to know how our sampling effort compares to the diversity and richness of the community. This can be done by calculating collector’s curves or rarefaction curves.
mothur > collect.single() mothur > rarefaction.single()
These commands will produce several files. The sobs file returns the number of observed OTUs for any given OTU definition whereas the rarefaction file returns the average number of OTUs for any given OTU definition by randomly re-sampling the dataset several times. In our case, both curves basically answer the same question, namely how diverse our community is and how well our sampling effort covers this diversity. Open the sobs and/or rarefaction files for the SSURIS, SSU and RIS dataset and plot the curves at OTU definition of 0.03 in Excel or any other suitable program. The distance 0.03 is often used to group sequences at around species level based on the SSU gene.
Whereas the curves calculated from the SSU sequence start to get somewhat parallel to the x-axis, the SSU-RIS and RIS-based curves are still very steep. The sampling effort of 2063 sequences might be adequate based on the SSU sequence dataset; however, the coverage is still rather poor when using the hypervariable RIS region as a standard. Of course, using full-length SSU sequences rather than partial SSU sequences might change this picture. In conclusion, based on SSU gene sampling and therefore potentially down to genus or species level, we might have reached satisfying coverage, but coverage is poor for distinction of community structures at a finer scale as achieved with ribosomal intergenic spacers.
Richness and diversity indices
Both commands, collect.single or rarefaction.single can be used to calculate richness and diversity estimators such as Chao1, ACE, shannon, or simpson to mentioned only some popular estimators. For some analyses, only the final estimators are of interest, which can be calculated with the summary.single command. It is interesting to know at which OTU distance levels the information content regarding richness/diversity is levelling off for the two different genetic regions, i.e. SSU and RIS. Start over and run:
mothur > read.dist(pyhlip=BACT_SSU.almafft.dist) mothur > cluster() mothur > summary.single()
and
mothur > read.dist(pyhlip=BACT_RIS.almafft.dist) mothur > cluster() mothur > summary.single()
Choose your favourite richness and/or diversity estimator and plot the estimators for all OTU definition levels determined by mothur. Richness and diversity estimators show again that a more detailed community structure is resolved by using hypervariable regions such as RIS. In our example, SSU-based richness/diversity become 0 at distances of around 0.4, RIS-based estimators at distances of around 1.4.
Alignment control
Based on our genetic region, we had to use a target-independent alignment tool, but we know that different alignment algorithms can influence the clustering results. In order to evaluate the quality of our alignment, we can compare our SSU alignment created with MAFFT or any other alignment software to the 16S-aligner implemented in mothur. This does not give us confidence that the alignment of the hypervariable region is accurate, but at least determines if both alignment algorithms perform similarly at the SSU level. For this purpose, we will align the SSU sequences against the greengenes database using the following pipeline:
- Open the file BACT_SSU.almafft.fasta in the text editor and remove all gaps, e.g. by using the find/replace function.
- Save the file as BACT_SSU.fasta and copy it into the mothur folder
- Download the greengenes reference alignment and unpack it to the mothur folder
- Use the following command to align your SSU sequences to the reference database
mothur > align.seqs(candidate=BACT_SSU.fasta, fasta=core_set_aligned.imputed.fasta)
The new alignment file BACT_SSU.kmer.needleman.nast.align will be generated. The reference alignment contains 7,692 columns by default. Since we do not require all columns for our analysis, we will apply a filter to remove the columns that have gaps in all sequences:
mothur > filter.seqs(fasta=BACT_SSU.kmer.needleman.nast.align, trump=., vertical=T)
Now we run our pipeline again
convert fasta to phylip (BACT_SSU.kmer.needleman.nast.align.filter.phy) generate distance matrix (BACT_SSU.kmer.needleman.nast.align.filter.dist) mothur > read.dist(phylip=BACT_SSU.kmer.needleman.nast.align.filter.dist) mothur > cluster(cutoff=0.10) mothur > rarefaction.single()
Compare the rarefaction curves of the files BACT_SSU.almafft.dist and BACT_SSU.kmer.needleman.nast.align.filter.dist by plotting them into the same diagram. The two curves are almost congruent, which means that both alignment algorithms lead to a very similar OTU clustering.
Eukaryal dataset
Perform the same kind of analysis for the eukaryal dataset. Results are very similar to the bacterial dataset, namely that SSU sequences are much more conserved and give a reasonable coverage of the diversity with the current sampling effort, whereas the RIS sequences resolve on a finer scale at which the diversity is hardly covered yet by the sampling effort.
Outlook and discussion
Apparently, different genetic regions will have different capabilities to distinguish communities based on OTU-approaches. In general, the OTU binning is only as accurate as the underlying alignment, which makes the alignment accuracy the needle eye of the analysis. Hypervariable regions, which are considered to have a high potential in distinguishing very closely related phylotypes, are difficult to properly align and might therefore bias OTU clustering, particularly when large datasets are used that cannot be manually corrected. We are currently developing an analysis pipeline that uses mothur and alignment algorithms to generate more accurate OTU binning for hypervariable regions. I will discuss this pipeline in this tutorial as soon as it becomes available.